Thapsigargin Is a Broad-Spectrum Inhibitor of Major Human Respiratory Viruses: Coronavirus, Respiratory Syncytial Virus and Influenza A Virus

Abstract

The long-term control strategy of SARS-CoV-2 and other major respiratory viruses needs to include antivirals to treat acute infections, in addition to the judicious use of effective vaccines. Whilst COVID-19 vaccines are being rolled out for mass vaccination, the modest number of antivirals in use or development for any disease bears testament to the challenges of antiviral development. We recently showed that non-cytotoxic levels of thapsigargin (TG), an inhibitor of the sarcoplasmic/endoplasmic reticulum (ER) Ca²⁺ ATPase pump, induces a potent host innate immune antiviral response that blocks influenza A virus replication. Here we show that TG is also highly effective in blocking the replication of respiratory syncytial virus (RSV), common cold coronavirus OC43, SARS-CoV-2 and influenza A virus in immortalized or primary human cells. TG’s antiviral performance was significantly better than remdesivir and ribavirin in their respective inhibition of OC43 and RSV. Notably, TG was just as inhibitory to coronaviruses (OC43 and SARS-CoV-2) and influenza viruses (USSR H1N1 and pdm 2009 H1N1) in separate infections as in co-infections. Post-infection oral gavage of acid-stable TG protected mice against a lethal influenza virus challenge. Together with its ability to inhibit the different viruses before or during active infection, and with an antiviral duration of at least 48 h post-TG exposure, we propose that TG (or its derivatives) is a promising broad-spectrum inhibitor against SARS-CoV-2, OC43, RSV and influenza virus.

1. Introduction

In the midst of COVID-19 pandemic, the need for effective vaccines for mass vaccination has never been greater to control and prevent rampant morbidity, mortality and surging clinical cases that can overwhelm hospitals. COVID-19 is caused by a novel coronavirus, designated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an enveloped positive single-strand RNA virus [1]. Although COVID-19 vaccines are now in deployment, eradication is unrealistic and there is an unmet parallel need for effective SARS-CoV-2 antivirals [2,3] to inhibit active virus replication in patients to reverse virus progression. Given that not all vaccines will necessarily prevent virus shedding in subsequent infection, antivirals could also serve to reduce the overall virus levels circulating in a population, thus reducing its spread. The modest number of antivirals in use or in development for any infectious disease bears testament to the practical challenges of antiviral development. A major obstacle commonly encountered, especially with respiratory viruses, is the emergence of virus mutational resistance, which stems from a commonly adopted strategy of directly targeting a specific part of a virus. Resistance of the N1 moiety of influenza A viruses to oseltamivir, a viral neuraminidase inhibitor, presents a growing concern [4,5]; there is also alarming concern over growing resistance to baloxavir marboxil, a recently introduced influenza antiviral that targets the viral PA protein [6]; and a mutation in the PB1 gene of influenza A virus readily confers resistance to favipiravir, a novel nucleoside analogue antiviral [7]. An alternative approach to antiviral design that can potentially circumvent the challenges of virus mutations is to regulate generic host innate immune responses during early infection to sufficiently disrupt virus replication to allow acquired immunity (antibody and cell-mediated) to be established. This novel host-centric antiviral approach can have the added benefit of inhibiting different types of viruses [8]. Given that acute respiratory virus infections of different aetiologies are clinically indistinguishable on presentation, a broad-spectrum host-centric antiviral that can target different virus types at the same time could significantly alter clinical management.

Besides the present SARS-CoV-2 pandemic, influenza A virus and respiratory syncytial virus (RSV) continue to be important contributors to prevailing human respiratory viral infections. Influenza viruses are enveloped negative-sense segmented single-strand RNA viruses that globally cause up to 650,000 deaths each year and have been responsible for previous pandemics [9]. RSV is an enveloped negative-sense single-strand RNA virus and a leading cause of acute lower respiratory tract infection in young children and elderly people, associated with 48,000–74,500 in-hospital deaths in children aged under 5 years, with 99% of these deaths occurring in developing countries [10,11]. Whilst use of antivirals in influenza A virus infections is potentially hampered by virus resistance, use of the only approved chemical antiviral, ribavirin, against RSV is limited to severe infections in infants [5,12].

We recently showed that thapsigargin (TG), an inhibitor of the sarcoplasmic/endoplasmic reticulum (ER) Ca²⁺ ATPase pump [13], at nano-molar non-cytotoxic levels induces a potent host antiviral response that blocks influenza A virus replication [14]. The TG-induced ER stress unfolded protein response (UPR) appears as the primary driver responsible for activating a downstream spectrum of host antiviral defences. Here we show that TG is, in fact, a broad-spectrum host-centric inhibitor, highly effective in blocking the replication of RSV, common cold coronavirus OC43, SARS-CoV-2 and influenza A virus in immortalized or primary human cells. We also establish that TG is low pH-stable, as found in the stomach, able to rapidly induce a potent antiviral state lasting at least 48 h from a single priming, and therapeutically protective (in vivo) in mice, when orally administered post-infection, against a lethal influenza virus challenge.

2. Materials and Methods

2.1. Cells and Viruses

Primary normal human bronchial epithelial (NHBE) cells and bronchial epithelial growth media were supplied by Promocell (Heidelberg, Germany). Immortalised neonatal porcine tracheal epithelial (NPTr) cells [15], HEp2 cells, MRC5 cells, A549 cells, Calu-3 cells, Vero E6 cells and MDCK cells were cultured in DMEM-Glutamax supplemented with 10% foetal calf serum (FCS) and 100 U/mL penicillin–streptomycin (P/S) (Gibco, ThermoFisher Scientific, Paisley, UK).

Human RSV (A2 strain, ATCC VR-1540), USSR H1N1 (A/USSR/77), PR8/H1N1 (A/PR8/1934) and pdm H1N1 virus (A/Swine/England/1353/2009 isolated through the DEFRA SwIV surveillance programme SV3401) were used in this study. Human coronavirus OC43 (OC43) and SARS-CoV-2 virus (strain 2019-nCoV/Italy-INMI1, clade V acquired from EVAg (008V-03893) were also used. The latter’s complete sequence was submitted to GenBank (SARS-CoV-2/INMI1-Isolate/2020/Italy: MT066156) and is available on GISAID website (betaCoV/Italy/INMI1-isl/2020: EPI_ISL_410545).

2.2. Cell Viability Assays

Cell viability was determined using a CellTiter-Glo Luminescent Cell Viability Assay kit or CellTiter-Glo 2.0 Cell Viability Assay (Promega, Madison, WI, USA), according to manufacturer’s instructions.

2.3. Chemical Priming of Cells

Stock TG (Merck, St. Louis, MO, USA) and remdesivir (Selleckchem, Munich, Germany) were dissolved in DMSO while ribavirin and hydroxychloroquine (Merck) were dissolved in water, as per the manufacturer’s recommendations. The antiviral regimen of the compounds had no detectable adverse effect on cell viability. Typically, unless otherwise described, cells were incubated in the indicated compound diluted in the appropriate cell culture medium (used within 30 min of dilution) for 30 min prior to infection, washed three times with PBS and infected with the indicated virus as described (pre-infection priming). Alternatively, cells were first infected for a specified period and then compound primed for 30 min followed by a continued infection culture (post-infection priming). All TG priming of cells was for a duration of 30 min only, followed by washing with PBS and downstream culturing according to specific experiments.

2.4. RSV Infection and Progeny Virus Quantification

HEp-2 cells, A549 cells and NHBE cells were infected at a specified multiplicity of infection (MOI) of RSV, based on 24 h plaque assays, in DMEM-Glutamax supplemented with 2% FCS for a total period of 48 or 72 h, and the spun supernatants collected for quantification by plaque assay or virus copy number by RT-qPCR (see Section 2.6). Titration of RSV by plaque assay on HEp2 cells has previously been described [16]. Briefly, HEp2 cells infected for 24 h with serial dilutions of the supernatants from infected cells (in triplicate) were fixed in acetone:methanol (1:1) and immunostained using mouse anti-RSV (2F7) antibody (1:1000) (Abcam, Cambridge, UK).

2.5. Influenza and Coronavirus Single and Co-Infection, and Progeny Virus Quantification

Influenza A virus infection requires serum-free medium supplemented with trypsin. The infection medium of the NPTr cells and A549 cells was Opti-MEM I (Gibco) supplemented with 100 U/mL P/S, 2 mM glutamine and 200 ng/mL L-1-tosylamide-2-phenylethyl chloromethyl ketone (TPCK) trypsin (Sigma-Aldrich). Cells were infected with a specified MOI of the influenza virus, based on focus forming assay (FFA), for 2 or 3 h in infection media, after which they were washed three times with PBS and incubated in fresh infection media for a period of 24 to 72 h, as indicated. Spun supernatants were collected for progeny virus quantification by 6 h FFA, tissue culture infectious dose 50% (TCID₅₀) or virus copy number by RT-qPCR. Influenza virus titration by FFA has been previously described [14].

A549 cells and MRC5 cells were infected with a specified MOI of OC43, based on FFA, for 3 h in Opti-MEM I supplemented with 100 U/mL P/S, 2 mM glutamine and 100 ng/mL TPCK trypsin, after which they were washed three times with PBS and incubated in fresh infection media for a total of up to 72 h. A549 cells co-infected with the OC43 and USSR H1N1 virus were similarly treated. Spun supernatants were collected for progeny virus quantification by FFA or virus copy number by RT-qPCR.

Calu-3, NHBE and Vero E6 cells were infected with SARS-CoV-2 at the indicated MOI, based on TCID₅₀, for 3 h in Opti-MEM I supplemented with 100 U/mL P/S, 2 mM glutamine and 100 ng/mL TPCK trypsin, subsequently washed three times in PBS and incubated in fresh infection media for a total of up to 72 h, as indicated. Calu-3 cells co-infected with the pdm H1N1 virus and SARS-CoV-2 virus were similarly treated. Spun supernatants were collected for progeny virus quantification by TCID₅₀ or virus copy number by RT-qPCR. TCID₅₀ titrations for quantification of SARS-CoV-2 and influenza A virus were performed in the 96-well plate format, in quadruplicate as the minimum. Ten-fold dilutions were made of each sample in the growth media DMEM (Gibco). Then, 50 µL of diluted samples were added to MDCK and Vero E6 cells for influenza and SARS-CoV-2 titrations, respectively, and incubated at 37 °C for 1 h. The media was then replaced with 200 µL DMEM (supplemented with 200 ng/mL of TPCK trypsin for influenza titration) and incubated for 5 days at 37 °C. Each well was assessed for cytopathic effects under a microscope. Virus titres were calculated using the Spearman–Karber method as TCID₅₀ [17,18]. The limit of detection was 5.62 TCID₅₀/mL.

2.6. RNA Preparation and Real-Time RT-PCR

The RNeasy Plus Minikit (Qiagen, Hilden, Germany) was used to extract total RNA from cells. cDNA was synthesised from 1 µg of total RNA using the Superscript III First Strand synthesis kit (ThermoFisher Scientific). Expression of host genes was performed with a LightCycler−96 instrument (Roche, Basel, Switzerland). Computation of gene expression was based on the comparative Ct approach, normalised to 18S ribosomal RNA. Human ER stress primers for HSPA5 (FH1_HSPA5 and RH1_HSPA5), HSP90B1 (FH1_HSP90B1 and RH1_HSP90B1) and DDIT3 (FH1_DDIT3 and RH1-DDIT3); and human IFNB1 primers (FH1_IFNB1 and RH1_IFNB1), OAS1 primers (FH1_OAS1 and RH1_OAS1) and RNASEL primers (FH1_RNASEL1 and RH1_RNASEL1) were pre-made designs from Sigma-Aldrich. Additional primers (synthesised by Sigma-Aldrich) were designed using PrimerExpress 3.0.1 (ThermoFisher Scientific) and are shown in

Table 1. Primer sequences.

Gene	Sense Primer (5′–3′)	Antisense Primer (5′–3′)
18S ribosomal RNA (universal)	ACGGCTACCACATCCAAGGA	CCAATTACAGGGCCTCG-AAA
F gene (RSV)	CAAGAACTGACAGAGGATGGTACTG	CATGTTTCAGCTTGTGGGAAGA
L gene (RSV)	AACACTTATCCTTCTTTGTTGGAACTTA	GCAACCGAAACTCACGATAGAAA
M-gene (RSV)	ACTCAAGAAGTGCAGTGCTAGCA	AAGGACACATTAGCGCATATGGT
RIG-I (human)	GAAGGCATTGACATTGCACAGT	TGGTTTGGATCATTTTGATGACA
M-gene (USSR H1N1)	AGATGAGCCTTCTAACCGAGGTCG	TGCAAAAACATCTTCAA-GTCTCTG
M-gene (pdm H1N1)	AGATGAGTCTTCTAACCGAGGTCG	TGCAAAGACACTTTCCA-GTCTCTG
Orf1ab (SARS-CoV-2)	CCGATCATCAGCACATCTAGGTT	GACAAGGCTCTCCATCT-TACCTTT
Orf1ab (OC43)	GCCAGGGACGTGTTGTATCC	TTGATCTTCGACATTGTGACCTATG

. The QIAamp Viral RNA Mini Kit (Qiagen) was used to extract viral RNA from the spun cell culture supernatants. One-step real-time qPCR was performed using the QIAGEN OneStep RT-PCR KIT to quantify relative virus copy number.

2.7. Western Blotting

Radioimmunoprecipitation assay (RIPA) buffer (Santa Cruz, Dallas, TX, USA), supplemented with 1% phenylmethylsulfonyl fluoride (PMSF) (Santa Cruz), 1% inhibitor cocktail and 1% sodium orthovanadate, was used to lyse the cells, and the protein concentration was measured by Bio-RAD protein assay (Bio-Rad, Hercules, CA, USA). Primary antibodies were goat anti-influenza A M1 at a 1:500 dilution (Abcam, ab20910), mouse anti-influenza A M2 clone 14C2 at 1:1000 (Invitrogen, MA1082), goat anti-influenza A virus polyclonal antibody at a 1:2000 dilution (Abcam, ab155877), mouse anti-coronavirus antibody OC-43 strain, clone 541–8F at 1:1000 (Sigma-Aldrich, MAB9012) and mouse anti-β-actin clone AC-74 at 1:5000 (Sigma-Aldrich, A2228). The appropriate species-specific secondary antibodies were peroxidase-conjugated (Abcam) for chemiluminescence detection (Amersham ECL Western Blotting Detection Reagent, Marlborough, MA, USA).

2.8. Interferon-β (IFNβ) ELISA

IFNβ secretion was quantified in the cell culture supernatant by enzyme-linked immunosorbent assay (ELISA). The IFNβ ELISA (Human IFN-beta Quantikine ELISA Kit, Bio-Techne, Minneapolis, MN, USA) was performed according to the manufacturer’s instructions. The samples were analysed in triplicate.

2.9. Influenza Virus Challenge in Mice

To assess the antiviral effectiveness of TG during infection (i.e., post-infection) and compare its performance with oseltamivir in vivo, 6- to 8-week-old BALB/c mice (female) were divided into two groups to determine post-infection survival (n = 8 per treatment group) and progeny virus production (n = 8 per treatment group). The mice were intranasally infected with 3 MLD₅₀ of PR8/H1N1 virus. Twelve hours post-infection, TG (1.5 μg/kg/day), oseltamivir (45 mg/kg/day) or PBS+DMSO (percentage DMSO in PBS-DMSO control equal to other treatments) was orally administered by gavage daily for 5 days. At 3 and 5 days post-infection, the lungs of four mice from each group were collected for viral titration. Virus titration was performed by TCID₅₀ assays on MDCK cells inoculated with 10-fold serially diluted homogenised lung tissues and incubated at 37 °C for 72 h. The TCID₅₀ values were calculated according to the Reed–Muench method [19].

2.10. Quantification and Statistical Analysis

Statistical analysis was performed using GraphPad Prism 7 and the statistical method used described in the figure legend. A p-value < 0.05 was considered significant, and indicated as * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001. The Kaplan–Meier method was employed for the survival analysis. The presented results are representative of three or more independent repeats, and the error bars, unless otherwise stated, are standard deviations.

2.11. Ethics Statement

All animal work was approved by the Beijing Association for Science and Technology (ID: SYXK (Beijing) 2007–0023) and conducted in accordance with the Beijing Laboratory Animal Welfare and Ethics guidelines, as issued by the Beijing Administration Committee of Laboratory Animals, and in accordance with the China Agricultural University Institutional Animal Care and Use Committee guidelines (ID: SKLAB-B-2010–003).

3. Results

3.1. TG Blocks Progeny RSV Production

To demonstrate the antiviral activity of TG against RSV, human HEp2 and A549 cells were briefly primed with TG for 30 min at either 24 h before infection (Figure 1A) or 24 h post-infection (hpi) (Figure 1B). Pre-infection and post-infection TG priming of each cell type resulted in dramatic, statistically significant, reduction in progeny virus production. HEp2 cells primed with 0.5 µM TG before infection reduced progeny virus production by almost 10,000-fold (Figure 1A); cells primed with 0.5 µM TG at 24 hpi reduced virus output by approximately 1000-fold (Figure 1B), which respectively suggests its prophylactic and therapeutic antiviral potential against RSV. A single 30-min priming of HEp2 and A549 cells with TG induced a potent antiviral state that lasted at least 48 h (Figure 1C,D). TG priming of HEp2 cells (immediately before infection or 48 h before infection) targeted transcriptional inhibition of the viral L, F and M genes (Figure 1E,F). The antiviral regimen of TG used was non-cytotoxic in HEp2 and A549 cells (Figure 1G,H). Additional evidence of non-cytotoxic antiviral dose regimen of TG is found in our earlier publication [14]. Thus, TG as a non-cytotoxic inhibitor was rapid-acting, induced an antiviral state in cells lasting at least 48 h in duration, and was effective when used before or during active RSV infection.

Next, the antiviral performance of TG was compared with ribavirin, an approved antiviral for use on young children with severe RSV infection, according to progeny virus output (Figure 2A) and viral RNA detection (Figure 2B) in media of infected HEp2 cells. TG was superior to ribavirin in blocking RSV replication. For instance, pre-infection priming of HEp2 cells with 0.1 µM TG for 30 min was 160-fold more inhibitory to progeny virus production than the continuous use of ribavirin at 30 µM (ribavirin effective concentration at 50% (EC₅₀) against RSV = 11 µM [20]) (Figure 2A). TG exhibited a selectivity index (cytotoxic concentration at 50% (CC₅₀)/EC₅₀) of 984 and EC₉₀ of 84.55 nM in RSV inhibition in HEp2 cells, suggesting a strong safety margin (Figure 2C,D). In TG-primed and infected primary NHBE cells, reduced viral RNA detection in the corresponding media (Figure 2E) was coincident with transcriptional inhibition of viral L, F and M genes (Figure 2F), which was further manifested as a TG dose-dependent reduction in viral protein production (Figure 2G,H). Taken together, TG was more effective than ribavirin as an antiviral, showed a strong selectivity index and blocked RSV virus transcription and viral protein production.

In primary NHBE cells, pre-infection priming with TG enhanced expression of the ER stress genes (DDIT3, HSPA5 and HSP90B1), relative to the DMSO control, before and during RSV infection in a TG dose-dependent manner (Figure 3A,C). TG also increased the basal expression of the RIG-I signalling-associated genes (RIG-I, IFNB and RNASEL) in NHBE cells, but during infection, the RIG-I-associated gene induction, relative to the infected DMSO control, was noticeably attenuated (Figure 3D,G). Thus, the reduced transcriptional induction of the RIG-I-associated genes during RSV infection in NHBE cells was a feature of TG-mediated RSV inhibition.

3.2. TG Blocks Progeny Coronavirus OC43 Production

To demonstrate TG inhibition of coronaviruses, A549 cells were primed with TG for 30 min immediately prior to infection with endemic OC43 virus [21] (Figure 4A–C). In a dose dependent manner, TG blocked virus replication, as evidenced by the sharp reduction in viral RNA in the media of infected cells (Figure 4A), inhibition in viral transcription (Figure 4B) and reduced viral NP protein production (Figure 4C). The antiviral performance of TG was compared with hydroxychloroquine (HC), a less toxic compound than chloroquine shown to inhibit OC43 [22]. TG was much more effective than HC in blocking the production of progeny OC43 virus (Figure 4D,E). Pre-infection priming with 0.05 µM TG for only 30 min was more inhibitory to OC43 than the continuous use of HC at 20 µM throughout infection (HC EC₅₀ against SARS-CoV-2 = 4.51 µM [23]) (Figure 4D). Unlike the modest reduction in progeny virus from HC treatment, hardly any virus was detected in the media of the TG-primed infected cells (Figure 4E). In A549 cells, TG was significantly better able than remdesivir (RDV) [24], a nucleoside analogue recently approved for emergency use in SARS-CoV-2 infection, at blocking OC43 virus (Figure 4F) and influenza virus (Figure 4G) replication. Although, at 72 hpi, cells continuously exposed to 0.3 µM RDV (RDV EC₅₀ against OC43 = 0.15 µM [24]) showed around a 17,000-fold reduction in progeny viral RNA detection (relative to corresponding DMSO control); cells primed with 0.3 µM TG, in turn, was more inhibitory than the RDV-treated cells by 450-fold (Figure 4F). At 72 hpi, 0.05 µM TG-primed cells also inhibited USSR H1N1 virus production more than the continuous use of RDV at 0.3 µM by 7-fold; RDV had little antiviral effect on influenza virus replication (Figure 4G). The antiviral use of TG in A549 cells was non-cytotoxic (Figure 4H). The selectivity index (CC₅₀/EC₅₀) of TG on OC43 in MRC5 cells was high at between 7072 and 9227 (Figure 4I). Collectively, TG strongly inhibited OC43 virus transcription and protein production, was more effective as an antiviral than HC and RDV and exhibited a high selectivity index.

Next, the ER stress response to TG priming before and during OC43 virus infection was assessed. In A549 cells, TG in a dose dependent manner stimulated the expression of the ER stress genes basally and during infection. The TG-induced ER stress gene profiles from OC43 infection of the A549 cells (Figure 5A,C) were highly similar to those from RSV infection of NHBE cells (Figure 3A,C). In A549 cells, TG priming appeared to have little effect on the basal transcription of the RIG-I-associated genes (RIG-I, IFNB and OAS1). Like in RSV infection of the NHBE cells (Figure 3D,G), induction of the RIG-I-associated genes was also attenuated during OC43 infection of the TG-primed cells (Figure 5D,F). Thus, reduced transcriptional induction of the RIG-I-associated genes during OC43 infection was also a feature of the TG-mediated OC43 virus inhibition. Importantly, pre-infection TG-primed A549 cells were just as able to inhibit separate virus infection (Figure 5G) as co-infection (Figure 5H) with the OC43 virus and USSR H1N1 influenza A virus. In summary, TG priming of A549 cells increased the expression of the ER stress genes basally and during OC43 infection, attenuated induction of the RIG-I signalling-associated genes during infection, and inhibited co-infection with the OC43 and influenza viruses.

3.3. TG Blocks Progeny SARS-CoV-2 Production

SARS-CoV-2 was as susceptible to TG inhibition as the OC43 virus. Pre-infection priming of Calu-3 and NHBE cells with TG blocked SARS-CoV-2 replication (Figure 6A,C), which is comparable to the inhibition seen with the OC43 virus in A549 and MRC5 cells (Figure 4A,D). In Calu-3 cells, post-infection priming with TG for 30 min at 24 hpi with SARS-CoV-2 was also effective in virus inhibition, indicating its therapeutic potential in SARS-CoV-2 infection (Figure 6B). As with influenza virus inhibition [14], TG was unable to inhibit the replication of SARS-CoV-2 in Vero E6 cells, suggesting that an intact type I IFN system is necessary for TG-mediated host antiviral response (Figure 6D).

The broad-spectrum antiviral potency of TG was just as evident in separate virus infections as in the co-infection with the SARS-CoV-2 and pdm H1N1 viruses, as determined by progeny viral RNA detection (Figure 6E–H) and infectious progeny virus detection by TCID₅₀ assays (Figure 6I–K) in the culture media of infected Calu-3 cells. At 72 hpi, 0.5 µM TG-primed cells inhibited production of the SARS-CoV-2 progeny virus by 300-fold (99.7%) and 880-fold (99.9%), relative to the corresponding DMSO controls, in single-virus infection (Figure 6I) and co-infection (Figure 6J), respectively. At 72 hpi of co-infected cells primed with 0.5 µM TG, production of the pdm H1N1 virus was reduced 11-fold (93.3%) (Figure 6K) relative to the corresponding DMSO control. Overall, reduction in progeny virus from TG priming was proportionally higher with SARS-CoV-2 than pdm H1N1 virus infection in single-virus comparison (Figure 6E,F) and co-infection (Figure 6G,H), suggesting that SARS-CoV-2 was more sensitive to TG inhibition than the pdm H1N1 virus. In summary, TG as a broad-spectrum antiviral targeted the major human respiratory viruses of RSV, coronaviruses (in particular SARS-CoV-2) and influenza A viruses, and did not distinguish between single-virus and combined-virus infections.

3.4. TG Post-Translational Block of Influenza A Virus Therapeutically Protects Mice in Lethal Virus Challenge

We previously found that TG inhibition of influenza virus replication in NHBE cells and NPTr cells was accompanied by little or no change in viral transcription or production in viral NP and M1 proteins, indicating that the virus was blocked post-translationally [14]. As viral NP and M1 proteins are translated on cytosolic ribosomes for nuclear import, we examined here the viral proteins (HA, NA and M2) that are processed through the ER-Golgi apparatus destined for the host cell membrane [25]. Viral protein analysis from TG-primed NPTr cells (Figure 7A,B) showed that expression of all the additional viral proteins examined appeared also to be unaffected, which indicates that TG differentially targets the replication cycle of the influenza virus, and RSV and coronavirus. As the antiviral effects of TG appeared stable in an acidic pH, but not an alkaline pH (Figure 7C,D), the oral therapeutic (post-infection) efficacy of TG was assessed in a lethal influenza virus challenge in mice. Each BALB/c mouse (n = 8 per group) in a group was first intranasally infected with 3 MLD₅₀ of the PR8/H1N1 virus and the next day was dosed with TG or oseltamivir by gavage once daily for 5 days. Protection conferred by low oral dose TG (empirically chosen at 1.5 μg/kg/day) was similar to that of high dose oseltamivir (45 mg/kg/day) in mice. Therapeutically, the TG-treated group showed significantly improved survival (Figure 7E), reduced virus shedding at 3 and 5 days post-infection (dpi) (Figure 7F) and less severe weight loss (Figure 7G,H) relative to the PBS-DMSO control. Seven, all eight and two mice survived in the TG, oseltamivir and PBS+DMSO group, respectively. There was no significant difference between the TG- and oseltamivir-treated mice in all three parameters. Thus, oral TG conferred therapeutic protection in mice subjected to a lethal influenza virus challenge.

4. Discussion

We recently reported that TG at non-cytotoxic levels induces a potent host antiviral response that blocks influenza A virus replication [14]. Here we further demonstrated that TG is an acid-stable, broad-spectrum inhibitor that is highly effective against RSV, coronavirus (OC43 and SARS-CoV-2) and influenza A virus. The three major RNA virus types represent diverse viral genomic makeup and life cycles. Here, the antiviral potency of TG is a physiological response to reversible ER stress activation, and is in stark contrast to the early experimental use of TG (at high µM concentrations over extended periods) as an inducer of apoptosis, which is an end-stage outcome of extreme ER stress. All accumulated evidence to date indicates that the antiviral regimen of TG is non-cytotoxic, showing high selectivity indices against RSV, OC43 virus and influenza virus, and is devoid of any overt adverse effects in mice. Previous work found no virus resistance arising from cell-passages of influenza A virus in continuous sub-optimal presence of TG [14]. The lasting antiviral state of at least 48 h from short TG exposure, along with its ability to inhibit different viruses before or during active infection, makes TG (or its derivatives) attractive as a prophylactic and therapeutic antiviral candidate. Additionally, TG’s antiviral performance was significantly better than RDV and ribavirin in their respective inhibition of coronavirus OC43 and RSV. A further advantage of TG as an antiviral is that it is just as inhibitory to coronaviruses (OC43 and SARS-CoV-2) and influenza viruses (USSR H1N1 and pdm H1N1) in separate infections as well as in co-infections. One of the major problems of influenza management is either the need to confirm infection by laboratory or rapid diagnostic test prior to instigating therapy; or to treat empirically and likely use influenza-specific therapy against non-influenza pathogens. A broad-spectrum antiviral such as TG may, in time, change this paradigm.

In the control of highly infectious diseases, effective vaccines and antivirals are necessary. In the present COVID-19 pandemic, vaccines have started to become available for mass vaccination. There is, however, no approved antiviral against COVID-19 for prophylaxis or early-infection community use in the general population. The WHO Solidarity Trial [26] found none of the antivirals examined (RDV, HC and IFNB1a) to have any significant impact on mortality or duration of hospitalisation. Other drugs in current use for the treatment of COVID-19, such as dexamethasone and hydrocortisone, are symptomatic immune modifiers that modulate the damaging effects of the virus-induced “cytokine storm” and are not antivirals. Thus, effective antivirals that can intervene during an active infection, especially at the initial stages of the disease, are very much needed, even with the availability of vaccines. Given the emergence of coronavirus mutants, which may undermine vaccines currently in use and under development, and other major respiratory viruses co-circulating in populations, effective antivirals that do not discriminate between virus types are all the more necessary to manage current and future pandemics. The enormous potential practical benefits of TG over current antivirals can be envisaged in general practice, if such an orally administered broad-spectrum antiviral could be dispensed for early intervention without the need to establish a specific respiratory virus diagnosis; such an antiviral will fulfil an integral role with vaccines in reducing the public health burden of SARS-CoV-2 and other respiratory viruses.

We previously established that TG-induced ER stress leading to UPR is a key innate immune driver that mediates a range of host-centric antiviral processes to block influenza A virus replication [14]. In a recent pre-print, TG was reported to efficiently inhibit coronavirus (hCoV-229E, MERS-CoV, SARS-CoV-2) replication at concentrations below its cytotoxic range [27]. The mechanistic antiviral basis arising from the primary ER stress response, however, remains to be fully elucidated. Noteworthy is that TG treatment triggers a downstream spectrum of generic host antiviral defences that are remarkably effective in blocking the replication of different RNA viruses. TG priming consistently increased the basal transcriptional expression of the ER stress genes (DDIT3, HSPA5 and HSP90B1) in a dose-dependent manner. Infection with the RSV and OC43 virus of the TG-primed cells further raised the ER stress gene expression but attenuated the induction of the RIG-I-associated genes. For both virus types, TG inhibition of progeny virus production was accompanied by a reduced viral transcription and viral protein expression. In contrast, as evidenced by no change in the detection of all viral proteins examined, TG targeted influenza virus replication post-translationally, possibly involving post-translational viral protein modifications and transport. Influenza virus infection of the TG-primed cells also attenuated the ER stress gene response but enhanced expression of the RIG-I-associated genes [14]. In summary, TG targets respiratory viruses at different stages of viral replication; RSV and coronavirus OC43 are inhibited from the level of transcription whereas influenza A virus is targeted post-translationally.

Differences in host ER stress and RIG-I-associated responses, and differences in virus-stage inhibition between infections with RSV and the OC43 virus, and influenza virus in TG-primed cells, indicate that there are functional redundancies in the multiple antiviral processes activated by TG to control different viruses at different stages of their life cycles. Thus, in TG-primed cells, transcriptional ER stress response to infection is virus-dependent. RSV and OC43 virus infection elicit strong ER stress gene expression in TG-primed cells, which, in turn, correlates with attenuated RIG-I-associated transcriptional activation; conversely, influenza virus infection attenuated the transcriptional activation of the ER stress genes in TG-primed cells, which is associated with elevated RIG-I-associated transcriptional activation. Notably, a functional type I IFN system appears essential in TG–ER stress-mediated inhibition of SARS-CoV-2 replication and influenza A virus replication [14]. Given that in TG-primed cells the RIG-I-associated response differed between RNA virus types, the qualitative response (such as temporal regulation) of this antiviral signalling pathway could be more important than the mere intensity of the response in inhibiting a specific virus replication. Regardless of the manner of ER stress response to infection, TG is manifestly highly protective against all three major virus types. In conclusion, we propose that TG (or its derivatives) is a promising orally active, broad-spectrum antiviral against SARS-CoV-2, RSV and influenza virus, and has the prospect to be a defender against the next Disease X pandemic.

5. Patents

The use of TG and other structurally-related compounds in antiviral therapy is covered by patent PCT/GB2019/050977 and PCT/GB2020/052479.